View Full Version : Collins: Why this scientist believes in God
NASpurs
04-04-2007, 09:17 PM
http://www.cnn.com/2007/US/04/03/collins.commentary/index.html
ROCKVILLE, Maryland (CNN) -- I am a scientist and a believer, and I find no conflict between those world views.
As the director of the Human Genome Project, I have led a consortium of scientists to read out the 3.1 billion letters of the human genome, our own DNA instruction book. As a believer, I see DNA, the information molecule of all living things, as God's language, and the elegance and complexity of our own bodies and the rest of nature as a reflection of God's plan.
I did not always embrace these perspectives. As a graduate student in physical chemistry in the 1970s, I was an atheist, finding no reason to postulate the existence of any truths outside of mathematics, physics and chemistry. But then I went to medical school, and encountered life and death issues at the bedsides of my patients. Challenged by one of those patients, who asked "What do you believe, doctor?", I began searching for answers.
I had to admit that the science I loved so much was powerless to answer questions such as "What is the meaning of life?" "Why am I here?" "Why does mathematics work, anyway?" "If the universe had a beginning, who created it?" "Why are the physical constants in the universe so finely tuned to allow the possibility of complex life forms?" "Why do humans have a moral sense?" "What happens after we die?" (Watch Francis Collins discuss how he came to believe in God (**********:cnnVideo('play','/video/bestoftv/2007/04/03/foreman.francis.collins.intv.cnn','2009/04/02');) http://i.a.cnn.net/cnn/.element/img/1.5/main/icon_video.gif (**********:cnnVideo('play','**********:cnnVideo(' play','/video/bestoftv/2007/04/03/foreman.francis.collins.intv.cnn','2009/04/02');','2007/04/04');))
I had always assumed that faith was based on purely emotional and irrational arguments, and was astounded to discover, initially in the writings of the Oxford scholar C.S. Lewis and subsequently from many other sources, that one could build a very strong case for the plausibility of the existence of God on purely rational grounds. My earlier atheist's assertion that "I know there is no God" emerged as the least defensible. As the British writer G.K. Chesterton famously remarked, "Atheism is the most daring of all dogmas, for it is the assertion of a universal negative."
But reason alone cannot prove the existence of God. Faith is reason plus revelation, and the revelation part requires one to think with the spirit as well as with the mind. You have to hear the music, not just read the notes on the page. Ultimately, a leap of faith is required.
For me, that leap came in my 27th year, after a search to learn more about God's character led me to the person of Jesus Christ. Here was a person with remarkably strong historical evidence of his life, who made astounding statements about loving your neighbor, and whose claims about being God's son seemed to demand a decision about whether he was deluded or the real thing. After resisting for nearly two years, I found it impossible to go on living in such a state of uncertainty, and I became a follower of Jesus.
So, some have asked, doesn't your brain explode? Can you both pursue an understanding of how life works using the tools of genetics and molecular biology, and worship a creator God? Aren't evolution and faith in God incompatible? Can a scientist believe in miracles like the resurrection?
Actually, I find no conflict here, and neither apparently do the 40 percent of working scientists who claim to be believers. Yes, evolution by descent from a common ancestor is clearly true. If there was any lingering doubt about the evidence from the fossil record, the study of DNA provides the strongest possible proof of our relatedness to all other living things.
But why couldn't this be God's plan for creation? True, this is incompatible with an ultra-literal interpretation of Genesis, but long before Darwin, there were many thoughtful interpreters like St. Augustine, who found it impossible to be exactly sure what the meaning of that amazing creation story was supposed to be. So attaching oneself to such literal interpretations in the face of compelling scientific evidence pointing to the ancient age of Earth and the relatedness of living things by evolution seems neither wise nor necessary for the believer.
I have found there is a wonderful harmony in the complementary truths of science and faith. The God of the Bible is also the God of the genome. God can be found in the cathedral or in the laboratory. By investigating God's majestic and awesome creation, science can actually be a means of worship.
THE ONE AND ONLY
04-04-2007, 10:24 PM
Why does he believe in God? Because he doesnt know all the answers to the questions he has. He takes a "leap of faith." Faith: belief in something with no proof. Just because we dont have the answers doesnt mean that God is the answer.
exstatic
04-04-2007, 10:30 PM
I think you can believe in God, and be a scientist. I do not, however, think that you can be a fundamentalist, every word in the Bible is literally true Christian, and be a scientist. Science requires a large dollop of skepticism, something that Fundamentalism will not brook.
whottt
04-04-2007, 10:58 PM
I think you can believe in God, and be a scientist. I do not, however, think that you can be a fundamentalist, every word in the Bible is literally true Christian, and be a scientist. Science requires a large dollop of skepticism, something that Fundamentalism will not brook.
Best exstatic post ever. Agree 100%. They've never been contrdictory philsophies except at the fundamental level. Evolution in no way disproves the existence of a higher power....more like a detailed explantion of how the changes occurr.
And Science doesn't have the answers for the origins of the Universe yet anyway.
In leiu of the actual knowledge, anything can sound like the stuff of fantasy.
Take you or I with modern technology and drop us 5000-10000 years into the past...with a story about the origin life and rules to live by, let us interract with a speices that evolves at the bio cultural level....
Think about how they'd interpret us....they wouldn't have the words to actually describe what they saw, or what they heard except at the most superficial level, the detailed words would not exist...it'd be very primitive language and pictures.
Think about how they'd see us......and then think about how those stories would have changed after 5000 years of being passed down and translated, and reinterpreted to the benefit of certain leaders time and time again.
The bottom line is that since Zarathrustra was the father of the Dharmic and Abrahamic religions, and basically all modern religions are just retranslations, with varying degrees of enlightenemnt of that philosophy...anything could have happened...there's still so much we don't know about ancient man and the rise of humans to sentience...
But anyway...I agree with your view and I wish more people shared it.
Shit...we don't even underatand much of anything about our remote ancestors, and quite a bit of the technology they used...much less the absolute origins of life and universe.
To me...the question is...how can anyone believe humans are the highest form of life in the Universe, we are the only sentient creatures in the universe?
I find that next to impossible to believe....Religion says we aren't(alrthough it says it in a confusing way)....and science has a similar underlying instinct.
mavs>spurs2
04-04-2007, 11:28 PM
Evolution is real. God is real. I believe both of these statements to be true.
Phenomanul
04-05-2007, 08:29 AM
Here we go again.
Bottom line... people will believe what they choose to believe. Their belief structure will comform to suit the needs of their life.
Let's not forget that many claims in science also require 'leaps of faith'... most just aren't aware, or don't care, or don't want to face that reality.
Phenomanul
04-05-2007, 08:44 AM
Why does he believe in God? Because he doesnt know all the answers to the questions he has. He takes a "leap of faith." Faith: belief in something with no proof. Just because we dont have the answers doesnt mean that God is the answer.
You really ought to read his book before sumarizing Collin's entire belief structure to the premise of "I don't know - that's why I believe in GOD".
It's much beyond that.
Let's not forget that many claims in science also require 'leaps of faith'... most just aren't aware, or don't care, or don't want to face that reality.
ie...
Fundamental LAW (Meaning no longer a theory) of nature: Matter can neither be created nor destroyed.
Right?
But there IS matter!
If it can't be created, where did it come from?
Could one of you Atheists please explain (without a leap of faith)?
:dizzy
Phenomanul
04-05-2007, 09:04 AM
ie...
Fundamental LAW (Meaning no longer a theory) of nature: Matter can neither be created nor destroyed.
Right?
But there IS matter!
If it can't be created, where did it come from?
Could one of you Atheists please explain (without a leap of faith)?
:dizzy
It was all pure energy before it condensed into matter.... (granted, I also believe that none of this existed until GOD said, "Let there be light".) But that's not what I was referring to.
I'm referring to selective assumptions on the creation of life's molecules from a 'prebiotic' soup. Or claims that the 'sudden' creation of DNA (or RNA) is chemically possible without regard to the relevance of the code, or the insurmountable entropic constraints required to create them. How all of their assumptions on said front fail to adequately harmonize the concepts established by chemistry, physics, and molecular biology (i.e. in order for their premises to stand, chemical or physical constraints are conveniently ignored). Furthermore, that the code itself defies all odds of random assortment; i.e. random chance cannot create purpose.
leemajors
04-05-2007, 09:53 AM
ie...
Fundamental LAW (Meaning no longer a theory) of nature: Matter can neither be created nor destroyed.
Right?
But there IS matter!
If it can't be created, where did it come from?
Could one of you Atheists please explain (without a leap of faith)?
:dizzy
uhh, it can easily be converted from one form to another. that doesn't take a leap of faith.
Phenomanul
04-05-2007, 10:02 AM
uhh, it can easily be converted from one form to another. that doesn't take a leap of faith.
That's only true in light of Albert Einstein's theories (particularly e=mc^2)... But if the question were rephrased to ask:
"Where did all the matter and energy come from", "has it always existed"....
The athiest would still have no answer.
It should be noted that Einstein later became a deist himself.
uhh, it can easily be converted from one form to another. that doesn't take a leap of faith.
converted != created
PixelPusher
04-05-2007, 10:31 AM
That's only true in light of Albert Einstein's theories (particularly e=mc^2)... But if the question were rephrased to ask:
"Where did all the matter and energy come from", "has it always existed"....
The athiest would still have no answer.
It should be noted that Einstein later became a deist himself.
"What is the moon made of?"
Guy 1: "I don't know"
Guy 2: "Cheese. I'm absolutely positive about it"
Guy 2 has "the answer", so Guy 2 must be correct, right Phenomanul?
"What is the moon made of?"
Guy 1: "I don't know"
Guy 2: "Cheese. I'm absolutely positive about it"
Guy 2 has "the answer", so Guy 2 must be correct, right Phenomanul?
If not an answer, it requires a "leap of faith" does it not?
That is what an earlier poster's problem with a belief in god was.
Phenomanul
04-05-2007, 10:40 AM
"What is the moon made of?"
Guy 1: "I don't know"
Guy 2: "Cheese. I'm absolutely positive about it"
Guy 2 has "the answer", so Guy 2 must be correct, right Phenomanul?
Read the context of the thread....
clambake
04-05-2007, 10:41 AM
With proof, it will end the need for faith. Saying an athiest has no answer? True. He's just not willing to build his house on a foundation of fantasy. It doesn't mean he's not interested in the truth.
leemajors
04-05-2007, 11:03 AM
converted != created
obviously, what's your point? circular arguments prove nothing. if that's all you've got, it's weak.
PixelPusher
04-05-2007, 11:05 AM
If not an answer, it requires a "leap of faith" does it not?
That is what an earlier poster's problem with a belief in god was.
I see. Better be Guy2 and take a leap of faith so that you have an "answer" than be Guy1 and live in doubt.
clambake
04-05-2007, 11:14 AM
Thanks to guy 2, guy 1 now has an answer. That's how you spread the word of God.
Phenomanul
04-05-2007, 11:36 AM
With proof, it will end the need for faith. Saying an athiest has no answer? True. He's just not willing to build his house on a foundation of fantasy. It doesn't mean he's not interested in the truth.
Or one can believe that GOD is absolute Truth.
clambake
04-05-2007, 11:41 AM
Yeah, if you rely on word from man. I'd rather examine the product before the salesman approaches.
Extra Stout
04-05-2007, 11:45 AM
An atheist, by definition, is not one who says, "I don't know the answer." That's an agnostic. An atheist has arrived at the answer that there is no God. And since there is neither positive or negative proof, the atheist has arrived at that answer through an inductive process similar to that of the religious person.
clambake
04-05-2007, 11:50 AM
You're right. I missed the connection and provided an inaccurate definition. Being athiest is also having blind faith.
THE ONE AND ONLY
04-05-2007, 11:56 AM
Science isnt a leap of faith. It requires experiments and tests based around the scientific method before it can be accepted. Try Putting God to the scientific method.
Phenom have you ever read the God Delusion or any atheist book? Or any religious book other than one of your own faith? I ask because I have only met two Jesus pushing people in my life that have looked outside their faith, and stuck with it.
To say that because I cant explain something so it must be Gods work is ridiculous. I am seeking the truth and the more I look for it in organized all I see is lies. Its possible there is a God but there is no reason I neen to worship Jesus. Most of organized religion is manmade.
THE ONE AND ONLY
04-05-2007, 12:00 PM
All Catholics believe in Adam and Eve right? Because without them there would be no original sin? Any Catholics out there?
Extra Stout
04-05-2007, 12:04 PM
Science isnt a leap of faith. It requires experiments and tests based around the scientific method before it can be accepted. Try Putting God to the scientific method.
Science is indeed powerful, but it is limited to the physical world. There are obviously other areas of human thought to which the scientific method is not applicable, and inductive rather than deductive reasoning must be used.
Spurminator
04-05-2007, 12:05 PM
the God Delusion
lol
clambake
04-05-2007, 12:11 PM
You do realize you've just suggested that someone should read the god delusion, as your counterpart would suggest you read the bible?
THE ONE AND ONLY
04-05-2007, 12:14 PM
You do realize you've just suggested that someone should read the god delusion, as your counterpart would suggest you read the bible?
Im just sdaying to be more open mided and take in mor eperspectives than those fed to you by your preacher.
THE ONE AND ONLY
04-05-2007, 12:15 PM
Science is indeed powerful, but it is limited to the physical world. There are obviously other areas of human thought to which the scientific method is not applicable, and inductive rather than deductive reasoning must be used.
The God in the Bible is very physical.
leemajors
04-05-2007, 12:20 PM
The God in the Bible is very physical.
Zeus liked to get more physical than He.
Extra Stout
04-05-2007, 12:28 PM
The God in the Bible is very physical.
Explain.
THE ONE AND ONLY
04-05-2007, 12:35 PM
He entered the physical world. He appeared to people, knocked up Mary, killed people,
If we had some of Jesus's hair wouldnt science show its composition as human and divine?
leemajors
04-05-2007, 12:37 PM
and here i was pretty sure angels appeared to people on God's behalf. the only "physical" (if even that) manifestation i can think of is appearing as a burning bush. God took a stroll down from heaven and knocked Mary up? priceless.
Extra Stout
04-05-2007, 12:50 PM
He entered the physical world. He appeared to people, knocked up Mary, killed people,
If we had some of Jesus's hair wouldnt science show its composition as human and divine?
OK, so God appeared to people through angels, burning bushes, visions, etc. That provides eyewitness evidence. If you find the eyewitness evidence credible, you believe in God. If you don't, I guess you keep on looking. The listener judges the credibility of the witness inductively, just as in a court of law on a jury.
The Bible says that God struck some people dead. It also says that he created the Earth. We wouldn't be having this discussion if the mere circumstance that the Earth exists were interpreted as incontrovertible physical evidence one way or the other about the existence of God. People look at the evidence and decide what they believe -- or do not believe -- inductively.
Mary had a child named Jesus according to the historical record. If you had the DNA in theory (since it is not in fact possible), I suppose you could attempt to determine the familial relation of Jesus to Mary. Since nobody has God's DNA, and since a non-corporeal spirit would be unlikely to have DNA in the first place, it would be difficult to compare Jesus's DNA to the Father's.
PixelPusher
04-05-2007, 12:52 PM
An atheist, by definition, is not one who says, "I don't know the answer." That's an agnostic. An atheist has arrived at the answer that there is no God. And since there is neither positive or negative proof, the atheist has arrived at that answer through an inductive process similar to that of the religious person.
These are the parameters by which I would describe myself as an agnostic as opposed to an athiest, the problem is these distinctions are always so clean and precise. For example: if "God doesn't exist, period!" = atheist, and "I really don't know one way or the other" = agnostic, then where does "I find no evidence for the existence of God as defined by x religion" fall into?
Does forming a hypothesis that God may not exist make one an atheist?
clambake
04-05-2007, 12:56 PM
It means you're using the intelligence God gave you! (haha)
Phenomanul
04-05-2007, 01:06 PM
Im just sdaying to be more open mided and take in mor eperspectives than those fed to you by your preacher.
And take them from who??? My search for truth has led me to GOD.
Don't just assume that my belief structure has somehow been handed down to me.... and that I 'blindly accepted' everything without question.
TDMVPDPOY
04-05-2007, 01:06 PM
the question is who believes in the bible?
every now and then a new revision comes out......so wtf is changing the stories or adding more myths in it?
Extra Stout
04-05-2007, 01:07 PM
These are the parameters by which I would describe myself as an agnostic as opposed to an athiest, the problem is these distinctions are always so clean and precise. For example: if "God doesn't exist, period!" = atheist, and "I really don't know one way or the other" = agnostic, then where does "I find no evidence for the existence of God as defined by x religion" fall into?
Does forming a hypothesis that God may not exist make one an atheist?
So you are an agnostic who leans toward atheism. What causes you to lean one way as opposed to the other? From what set of assumptions and/or values are you starting?
Extra Stout
04-05-2007, 01:15 PM
the question is who believes in the bible?
every now and then a new revision comes out......so wtf is changing the stories or adding more myths in it?
New "revisions" are in fact different translations. Since language is dynamic, and colloquial usage changes over time, failure to update translations leads to misunderstanding and misinterpretation. The Bible is written in three languages: the Old Testament is in ancient Hebrew and Aramaic, and the New Testament is written in 1st-century Greek. A translation into English from 1611 would be somewhat difficult to understand today, especially for the poorly-educated, since English has changed significantly in the past 400 years.
No translation reflects the full original meaning perfectly, because human languages do not correspond perfectly to one another in figures of speech. However, it is unlikely that people are all going to become fluent in ancient languages, so instead the holy texts are translated into the vernacular, while clergy and other scholars become educated in the ancient languages in order to understand and convey original meanings not fully transmitted through translation.
Phenomanul
04-05-2007, 01:20 PM
the question is who believes in the bible?
every now and then a new revision comes out......so wtf is changing the stories or adding more myths in it?
They just intend to make it more readable and understandable to our generation...
Made up example:
from ---
"...the feline wandered into thine house, that thou mayest see and believe. Verily, verily, I say unto you that the whiskered beast will conceive ten more..."
to ---
"... the cat came to your house so that you would see for yourself and believe. Truly, the cat will conceive 10 kittens..."
Of course the sentences above don't make any sense... but at least the second one is written in a more readable format. I agree that interpretative errors may at times be introduced into the text (sometimes on account of doctrinal agendas). Nevertheless, that's why people study the old texts, and try to understand the nuances of the Greek, Aramaic, and Hebrew passages since they do in fact provide better perspectives when understood from those contexts.
xrayzebra
04-05-2007, 02:14 PM
According to some on this board it is absolutely and scientifically
proven you should never believe in God. You should only believe
in what the Government sanctions and the Liberals believe in. You
know like global warming and the fight against poverty and the
killing of children while they are still the womb. Never, never
should anyone be held accountable for their own actions. It is
absolutely wrong to do that: Hold people accountable. There is
no right or wrong.
THE ONE AND ONLY
04-05-2007, 03:11 PM
Mary had a child named Jesus according to the historical record. If you had the DNA in theory (since it is not in fact possible), I suppose you could attempt to determine the familial relation of Jesus to Mary. Since nobody has God's DNA, and since a non-corporeal spirit would be unlikely to have DNA in the first place, it would be difficult to compare Jesus's DNA to the Father's.
Why isnt it possible? I bet Jesus cut his fingernails and trimmed his hair. We wouldnt need Gods DNA. Just by looking at Jesus's we would know that he is divine.
Are yall saying angels, visions, burning bushers, Jesus, and Mary getting knocked up are not physical? Such physical things can be studied by science if they existed.
PixelPusher
04-05-2007, 03:12 PM
So you are an agnostic who leans toward atheism. What causes you to lean one way as opposed to the other? From what set of assumptions and/or values are you starting?
It depends on which "God" you are referring to. If it's a non-religious deist view of God (The Einsteinian deism referred to ealier), then I remain agnostic, if it's the anthromorphized, activist God of Christianity, the Greek pantheon, Pre-Columbian myth, etc. - then I definitely lean atheistic. Of course, if presented with any deity other than the Christian vision of God, Christians will readily subscribe to an atheistic view of those gods and godesses as well.
THE ONE AND ONLY
04-05-2007, 03:17 PM
And take them from who??? My search for truth has led me to GOD.
Don't just assume that my belief structure has somehow been handed down to me.... and that I 'blindly accepted' everything without question.
Aparently my assumption was correct because you didnt answer my question. It is safe to assume that most peoples belief structure was handed down to them. Oh and blind faith is the same thing as faith. A priest taught me that. When you had questions to whom did you turn? The church or outside sources?
THE ONE AND ONLY
04-05-2007, 03:22 PM
the question is who believes in the bible?
every now and then a new revision comes out......so wtf is changing the stories or adding more myths in it?
Its an attempt to make sense out of senseless and contradictory stories. Religious authorities adjust the Bible to make it more acceptable to the faithful. A slave is a slave not a servant! They were not treated like servants but like slaves!
leemajors
04-05-2007, 03:28 PM
Why isnt it possible? I bet Jesus cut his fingernails and trimmed his hair. We wouldnt need Gods DNA. Just by looking at Jesus's we would know that he is divine.
Are yall saying angels, visions, burning bushers, Jesus, and Mary getting knocked up are not physical? Such physical things can be studied by science if they existed.
what other divine DNA samples would we have to compare it with? would His chromosomes line themselves up to spell divine?
THE ONE AND ONLY
04-05-2007, 03:30 PM
According to some on this board it is absolutely and scientifically
proven you should never believe in God. You should only believe
in what the Government sanctions and the Liberals believe in. You
know like global warming and the fight against poverty and the
killing of children while they are still the womb. Never, never
should anyone be held accountable for their own actions. It is
absolutely wrong to do that: Hold people accountable. There is
no right or wrong.
I hope you arent refering to me. Im not liberal or conservative. I hate it when people think you need to choose sides. You know there are other ethical philosophies out there than what God prescribes.
Extra Stout
04-05-2007, 03:32 PM
Why isnt it possible? I bet Jesus cut his fingernails and trimmed his hair. We wouldnt need Gods DNA. Just by looking at Jesus's we would know that he is divine.
Are yall saying angels, visions, burning bushers, Jesus, and Mary getting knocked up are not physical? Such physical things can be studied by science if they existed.
How would you know by looking at Jesus' DNA that Jesus is divine? What does divine DNA look like?
And how exactly in 2007 are you going to get fingerprint and hair samples anyway from a guy who lived in the first century, for whom you don't even know what you are looking for?
What about Mary's pregnancy would you be studying? Are you going to jump in a time machine back to 7 B.C. with a gynecologist to inspect whether her hymen is intact?
And no, I don't really hold that Christianity teaches that angels, visions, and burning bushes are physical manifestations of this world that could be studied by science., but rather spiritual manifestations.
Extra Stout
04-05-2007, 03:34 PM
It depends on which "God" you are referring to. If it's a non-religious deist view of God (The Einsteinian deism referred to ealier), then I remain agnostic, if it's the anthromorphized, activist God of Christianity, the Greek pantheon, Pre-Columbian myth, etc. - then I definitely lean atheistic. Of course, if presented with any deity other than the Christian vision of God, Christians will readily subscribe to an atheistic view of those gods and godesses as well.
And by what means do you arrive at those conclusions? Was it a deductive process, or one based upon your values and experiences?
THE ONE AND ONLY
04-05-2007, 03:34 PM
what other divine DNA samples would we have to compare it with? would His chromosomes line themselves up to spell divine?
Why does it need to be compared to his Father. This isnt the Maurey Povich Show. We could look at it and it would be something we have never seen before. That would make a believer out of me. In a way yes it would spell divine.
Spurminator
04-05-2007, 03:45 PM
People saw Christ perform miracles and remained skeptical... I highly doubt someone today who is armed with the Teenager's Guide to Claiming Intellectual Supremacy Through Atheism would be convinced by some DNA anomaly from a man who's been dead for two millenia.
Extra Stout
04-05-2007, 03:46 PM
Why does it need to be compared to his Father. This isnt the Maurey Povich Show. We could look at it and it would be something we have never seen before. That would make a believer out of me. In a way yes it would spell divine.
Why would it be something we have never seen before? Why wouldn't it just be 26 chromosomes' worth of double-helical strands of proteins? Are you thinking his DNA would spell out Bible codes or something?
THE ONE AND ONLY
04-05-2007, 03:48 PM
How would you know by looking at Jesus' DNA that Jesus is divine? What does divine DNA look like?
And how exactly in 2007 are you going to get fingerprint and hair samples anyway from a guy who lived in the first century, for whom you don't even know what you are looking for?
What about Mary's pregnancy would you be studying? Are you going to jump in a time machine back to 7 B.C. with a gynecologist to inspect whether her hymen is intact?
And no, I don't really hold that Christianity teaches that angels, visions, and burning bushes are physical manifestations of this world that could be studied by science., but rather spiritual manifestations.
We could see that his DNA is irregular.
Yeah i guess someone would have had to save some or something. We do have DNA from people and creatures from before Jesus's time. If that tomb the Titanic guy found had bodies the could be tested for DNA.
If we had a time machine we could.
Science teaches that visions, angels, and burning bushes can be studies. If they can be seen, touched, give off heat. ITs the churchs teachings that im questioning.
What are visions? Are they the same thing as me seeing my computer screen or more like a hallucination? Or something else?
THE ONE AND ONLY
04-05-2007, 03:53 PM
Why would it be something we have never seen before? Why wouldn't it just be 26 chromosomes' worth of double-helical strands of proteins? Are you thinking his DNA would spell out Bible codes or something?
I dont know much about DNA but dont we get half of it from our mom and half from our dad. Dad's half should be divine right? It would be something we havent seen because we havent seen it before. Bible codes? No. I just think it would be obvious.
THE ONE AND ONLY
04-05-2007, 03:58 PM
People saw Christ perform miracles and remained skeptical... I highly doubt someone today who is armed with the Teenager's Guide to Claiming Intellectual Supremacy Through Atheism would be convinced by some DNA anomaly from a man who's been dead for two millenia.
Majicians were nothing new to them. Are you kidding me that would be more proof than a Mother Teresa cinnamon bun. Maybe youre right, but it would be enough to convince me. I want to stick my fingers into Christs wounds.
Extra Stout
04-05-2007, 04:09 PM
We could see that his DNA is irregular.
Why would his DNA be irregular? What is your basis for assuming that?
Yeah i guess someone would have had to save some or something. We do have DNA from people and creatures from before Jesus's time. If that tomb the Titanic guy found had bodies the could be tested for DNA.
Yes, you probably could analyze DNA from a random person who lived around A.D. 30. No, you could not definitively identify a set of remains as belonging to Jesus of Nazareth, who claimed to be the Son of God.
If we had a time machine we could.
Time travel to the past is impossible by the laws of quantum physics. (Time travel to the future is possible by travelling at speeds approaching the speed of light.)
Science teaches that visions, angels, and burning bushes can be studies. If they can be seen, touched, give off heat. ITs the churchs teachings that im questioning.
You are assuming that these things, as described in the Bible, were actual physical objects composed of matter. Typically, we know from experience and observation, that when a plant is on fire, it gets burned up into CO2 and ashes. The burning bush Moses saw was not consumed by the flames. We also know that bushes usually do not talk; in fact, there are no observed cases of talking plants. But this bush claimed to be God, talked to Moses at length about the Law, and carved a pair of stone tablets for him.
The Bible presupposes a spiritual world of Heaven, and maintains that agents from that spiritual world interact with this physical world without being part of it, with the sole and remarkable exception of Jesus Christ.
What are visions? Are they the same thing as me seeing my computer screen or more like a hallucination? Or something else?The difference between a vision and a hallucination is one of semantics; namely, that a hallucination connotes the seeing of something which does not exist, whereas a vision connotes the seeing of something which is not of the physical world, and is revealing some kind of truth.
Extra Stout
04-05-2007, 04:20 PM
I dont know much about DNA but dont we get half of it from our mom and half from our dad. Dad's half should be divine right? It would be something we havent seen because we havent seen it before. Bible codes? No. I just think it would be obvious.
You're right, you don't know much about DNA. It begs the question of why a person with so little basic knowledge about science has such strong opinions about its being the be-all, end-all of human understanding.
The information contained in DNA basically is the sequential order of four characteristic molecules in the DNA chain. The particular order they come in defines the genetic instructions for the organism: GGCCTATGCTTACGGTATTT, etc.
One would be able to compare Jesus' DNA to Mary's, hypothetically, compare the order of their DNA chains, see that they are similar to one another to some very high percentages, and determine they are related.
But what "divine" DNA are you looking for? The Bible teaches that Jesus was fully human and fully God, not some half-man, half-God hybrid. He would have normal human DNA. He would not have some special molecule that looks like the star of David, nor would his genetic code have "YHWH" interspersed in there.
THE ONE AND ONLY
04-05-2007, 04:31 PM
Why would his DNA be irregular? What is your basis for assuming that?
Yes, you probably could analyze DNA from a random person who lived around A.D. 30. No, you could not definitively identify a set of remains as belonging to Jesus of Nazareth, who claimed to be the Son of God.
Time travel to the past is impossible by the laws of quantum physics. (Time travel to the future is possible by travelling at speeds approaching the speed of light.)
You are assuming that these things, as described in the Bible, were actual physical objects composed of matter. Typically, we know from experience and observation, that when a plant is on fire, it gets burned up into CO2 and ashes. The burning bush Moses saw was not consumed by the flames. We also know that bushes usually do not talk; in fact, there are no observed cases of talking plants. But this bush claimed to be God, talked to Moses at length about the Law, and carved a pair of stone tablets for him.
The Bible presupposes a spiritual world of Heaven, and maintains that agents from that spiritual world interact with this physical world without being part of it, with the sole and remarkable exception of Jesus Christ.
The difference between a vision and a hallucination is one of semantics; namely, that a hallucination connotes the seeing of something which does not exist, whereas a vision connotes the seeing of something which is not of the physical world, and is revealing some kind of truth.
A dogs DNA is different than a cats. A cats is different than a monkeys. Yeah Im just using logic and the things I do know to make my assumption that Jesus's DNA would be different than the typical humans as opposed to basing my belief on something I dont know.
True. But we would have some crazy ass DNA to study.
I could if I wasnt out of plutonium to power my flux capacitor.
If visions can be seen in the physical world they should have physical properties. Light from them is going into our eyeballs.
Extra Stout
04-05-2007, 04:35 PM
Yeah Im just using logic and the things I do know to make my assumption that Jesus's DNA would be different than the typical humans as opposed to basing my belief on something I dont know.
No, you are not using logic. You are using your ignorance both about genetics and about Christianity to make a totally nonsensical assertion, and then compounding your folly by arrogating intellectual superiority about it.
THE ONE AND ONLY
04-05-2007, 04:36 PM
You're right, you don't know much about DNA. It begs the question of why a person with so little basic knowledge about science has such strong opinions about its being the be-all, end-all of human understanding.
The information contained in DNA basically is the sequential order of four characteristic molecules in the DNA chain. The particular order they come in defines the genetic instructions for the organism: GGCCTATGCTTACGGTATTT, etc.
One would be able to compare Jesus' DNA to Mary's, hypothetically, compare the order of their DNA chains, see that they are similar to one another to some very high percentages, and determine they are related.
But what "divine" DNA are you looking for? The Bible teaches that Jesus was fully human and fully God, not some half-man, half-God hybrid. He would have normal human DNA. He would not have some special molecule that looks like the star of David, nor would his genetic code have "YHWH" interspersed in there.
The Bible says Jesus is completly human and completly divine. It also says that his mother was human and his father was divine. That sounds like a half breed to me.
THE ONE AND ONLY
04-05-2007, 04:40 PM
No, you are not using logic. You are using your ignorance both about genetics and about Christianity to make a totally nonsensical assertion, and then compounding your folly by arrogating intellectual superiority about it.
Admitting I dont know something isnt being aggogant. That shows your ignorance.
THE ONE AND ONLY
04-05-2007, 04:41 PM
I was wondering if you call yourself a Christian or something more specific?
Are you going to church of Friday?
Extra Stout
04-05-2007, 04:42 PM
The Bible says Jesus is completly human and completly divine. It also says that his mother was human and his father was divine. That sounds like a half breed to me.
Christians do not believe that God inseminated Mary with his divine sperm and fertilized her egg. They believe that God miraculously caused Mary to become pregnant.
Where is the "half-breed" DNA going to come from?
And why do you keep on this line of debate when it has been so thoroughly debunked, and you have demonstrated an utter lack of understanding of what you are talking about? Are you just trolling at this point?
Extra Stout
04-05-2007, 04:46 PM
Admitting I dont know something isnt being aggogant. That shows your ignorance.
Admitting you don't know something is not arrogant. Going on and forming strong opinions on the subject despite not knowing much is arrogant.
THE ONE AND ONLY
04-05-2007, 04:47 PM
Do you pray? Why?
Extra Stout
04-05-2007, 04:51 PM
Do you pray? Why?
Since I do not believe you are having this discussion in good faith any longer, and do not actually want to know about my prayer practices and motivation behind them, but rather are looking to be an irritant, a conclusion I come to based upon your performance up to this point, I respectfully decline to answer your question.
THE ONE AND ONLY
04-05-2007, 04:53 PM
Ok i admit the DNA thing got out of hand but you pushed it along as much as I did.
THE ONE AND ONLY
04-05-2007, 04:53 PM
I was wondering if you call yourself a Christian or something more specific?
Are you going to church of Friday?
How about answering these Stout?
Phenomanul
04-05-2007, 05:15 PM
I dont know much about DNA but dont we get half of it from our mom and half from our dad. Dad's half should be divine right? It would be something we havent seen because we havent seen it before. Bible codes? No. I just think it would be obvious.
Which is why you just can't call out one of the world's premier authorities on the matter and belittle his beliefs (Francis S. Collins). Disagree if you must, no one here is denying you that right. But don't insinuate that Collin's scientific viewpoints hold no merit whatsoever simply because he happens to believe in GOD.
Edit: Nevermind, I see ES completely dismantled your position already.
leemajors
04-05-2007, 05:24 PM
How about answering these Stout?
Since I do not believe you are having this discussion in good faith any longer, and do not actually want to know about my prayer practices and motivation behind them, but rather are looking to be an irritant, a conclusion I come to based upon your performance up to this point, I respectfully decline to answer your question.
THE ONE AND ONLY
04-05-2007, 05:28 PM
Which is why you just can't call out one of the world's premier authorities on the matter and belittle his beliefs (Francis S. Collins). Disagree if you must, no one here is denying you that right. But don't insinuate that Collin's scientific viewpoints hold no merit whatsoever simply because he happens to believe in GOD.
Edit: Nevermind, I see ES completely dismantled your position already.
I just googled him. Thats fucking hilarious.
Hey Phenom what church would you recomend in Corpus?
mikejones99
04-05-2007, 05:41 PM
I saw Jesus on Southpark last night. A jew, Kyle, killed him and he came back to save people for Easter.
mookie2001
04-05-2007, 06:21 PM
ROFL, im going to have to side with the one and only on this one
and also pfhenomanual has loads of scientific credentials, dont even make him list them again
mookie2001
04-05-2007, 06:22 PM
and whottt
and elpimpo
lil'mo
04-05-2007, 06:54 PM
:lmao
phemanuel, you and the one and only should go to church together in the cc
lil'mo
04-05-2007, 06:56 PM
Time travel to the future is possible by travelling at speeds approaching the speed of light.
really? in any direction?
jochhejaam
04-05-2007, 08:56 PM
Im just sdaying to be more open mided and take in mor eperspectives than those fed to you by your preacher.
Perhaps 90 - 99% of Christians lives have been subject to non-Christian perspectives, and in spite of that they've come to the conclusion that the 1% is the Truth.
That deserves a conclusion other then them being close-minded.
Bob Lanier
04-05-2007, 10:45 PM
http://www.drudgereport.com/siren.gifWARNING UNSTATED PREMISEhttp://www.drudgereport.com/siren.gif
Phenomanul
04-06-2007, 12:24 AM
ROFL, im going to have to side with the one and only on this one
Would that surprise anybody here???.... It pretty much goes unsaid with all the context provided by your posts.
and also pfhenomanual has loads of scientific credentials, dont even make him list them again
Again, your obsession over my educational background is rather disturbing.
clambake
04-06-2007, 12:25 AM
I think his question is more closely entangled with the existance of God and that relationship to organized religion.
Phenomanul
04-06-2007, 12:27 AM
I just googled him [Collins]. Thats fucking hilarious.
Which part??? the part where you called him out on his field of expertise... or
do you find him to be humorous??
Hey Phenom what church would you recomend in Corpus?
There are many, but Yorktown Baptist has a solid foundation.
clambake
04-06-2007, 12:42 AM
Why would someone need church to reinforce their belief in God?
(please don't let the answer be to help others by spreading the word)
This is a personnal question with a catch.
Mr. Peabody
04-06-2007, 07:37 AM
Perhaps 90 - 99% of Christians lives have been subject to non-Christian perspectives, and in spite of that they've come to the conclusion that the 1% is the Truth.
That deserves a conclusion other then them being close-minded.
Being subject to others' perspectives doesn't make you open-minded. You can listen to differing viewpoints all day and dismiss them without consideration. I think open/closed mindedness has to do with how you approach these different perspectives.
Spurminator
04-06-2007, 10:46 AM
Why would someone need church to reinforce their belief in God?
That's not what church is.
THE ONE AND ONLY
04-06-2007, 12:44 PM
Which part??? the part where you called him out on his field of expertise... or
do you find him to be humorous??
There are many, but Yorktown Baptist has a solid foundation.
The first part not the second
So I can get into heaven, duh. No seriously I go to different churches just for the hell of it. Kind of like a hobby. I hate it when the people that work at the church smell fresh meat and circle around me and bombard me with questions trying to get me to join. Ill check out YB sometime after Easter.
mookie2001
04-06-2007, 02:01 PM
pfhenomanual has credentials that make us all look like simeon grad students
Powered by vBulletin® Version 4.2.5 Copyright © 2026 vBulletin Solutions Inc. All rights reserved.