Reply With Quote
Why does it need to be compared to his Father. This isnt the Maurey Povich Show. We could look at it and it would be something we have never seen before. That would make a believer out of me. In a way yes it would spell divine.
And by what means do you arrive at those conclusions? Was it a deductive process, or one based upon your values and experiences?
Why does it need to be compared to his Father. This isnt the Maurey Povich Show. We could look at it and it would be something we have never seen before. That would make a believer out of me. In a way yes it would spell divine.
People saw Christ perform miracles and remained skeptical... I highly doubt someone today who is armed with the Teenager's Guide to Claiming Intellectual Supremacy Through Atheism would be convinced by some DNA anomaly from a man who's been dead for two millenia.
Why would it be something we have never seen before? Why wouldn't it just be 26 chromosomes' worth of double-helical strands of proteins? Are you thinking his DNA would spell out Bible codes or something?
We could see that his DNA is irregular.
Yeah i guess someone would have had to save some or something. We do have DNA from people and creatures from before Jesus's time. If that tomb the anic guy found had bodies the could be tested for DNA.
If we had a time machine we could.
Science teaches that visions, angels, and burning bushes can be studies. If they can be seen, touched, give off heat. ITs the churchs teachings that im questioning.
What are visions? Are they the same thing as me seeing my computer screen or more like a hallucination? Or something else?
I dont know much about DNA but dont we get half of it from our mom and half from our dad. Dad's half should be divine right? It would be something we havent seen because we havent seen it before. Bible codes? No. I just think it would be obvious.
Majicians were nothing new to them. Are you kidding me that would be more proof than a Mother Teresa cinnamon bun. Maybe youre right, but it would be enough to convince me. I want to stick my fingers into Christs wounds.
Why would his DNA be irregular? What is your basis for assuming that?
Yes, you probably could analyze DNA from a random person who lived around A.D. 30. No, you could not definitively identify a set of remains as belonging to Jesus of Nazareth, who claimed to be the Son of God.
Time travel to the past is impossible by the laws of quantum physics. (Time travel to the future is possible by travelling at speeds approaching the speed of light.)
You are assuming that these things, as described in the Bible, were actual physical objects composed of matter. Typically, we know from experience and observation, that when a plant is on fire, it gets burned up into CO2 and ashes. The burning bush Moses saw was not consumed by the flames. We also know that bushes usually do not talk; in fact, there are no observed cases of talking plants. But this bush claimed to be God, talked to Moses at length about the Law, and carved a pair of stone tablets for him.
The Bible presupposes a spiritual world of Heaven, and maintains that agents from that spiritual world interact with this physical world without being part of it, with the sole and remarkable exception of Jesus Christ.
The difference between a vision and a hallucination is one of semantics; namely, that a hallucination connotes the seeing of something which does not exist, whereas a vision connotes the seeing of something which is not of the physical world, and is revealing some kind of truth.
You're right, you don't know much about DNA. It begs the question of why a person with so little basic knowledge about science has such strong opinions about its being the be-all, end-all of human understanding.
The information contained in DNA basically is the sequential order of four characteristic molecules in the DNA chain. The particular order they come in defines the genetic instructions for the organism: GGCCTATGCTTACGGTATTT, etc.
One would be able to compare Jesus' DNA to Mary's, hypothetically, compare the order of their DNA chains, see that they are similar to one another to some very high percentages, and determine they are related.
But what "divine" DNA are you looking for? The Bible teaches that Jesus was fully human and fully God, not some half-man, half-God hybrid. He would have normal human DNA. He would not have some special molecule that looks like the star of David, nor would his genetic code have "YHWH" interspersed in there.
A dogs DNA is different than a cats. A cats is different than a monkeys. Yeah Im just using logic and the things I do know to make my assumption that Jesus's DNA would be different than the typical humans as opposed to basing my belief on something I dont know.
True. But we would have some crazy ass DNA to study.
I could if I wasnt out of plutonium to power my flux capacitor.
If visions can be seen in the physical world they should have physical properties. Light from them is going into our eyeballs.
No, you are not using logic. You are using your ignorance both about genetics and about Christianity to make a totally nonsensical assertion, and then compounding your folly by arrogating intellectual superiority about it.
The Bible says Jesus is completly human and completly divine. It also says that his mother was human and his father was divine. That sounds like a half breed to me.
Admitting I dont know something isnt being aggogant. That shows your ignorance.
I was wondering if you call yourself a Christian or something more specific?
Are you going to church of Friday?
Christians do not believe that God inseminated Mary with his divine sperm and fertilized her egg. They believe that God miraculously caused Mary to become pregnant.
Where is the "half-breed" DNA going to come from?
And why do you keep on this line of debate when it has been so thoroughly debunked, and you have demonstrated an utter lack of understanding of what you are talking about? Are you just trolling at this point?
Admitting you don't know something is not arrogant. Going on and forming strong opinions on the subject despite not knowing much is arrogant.
Do you pray? Why?
Since I do not believe you are having this discussion in good faith any longer, and do not actually want to know about my prayer practices and motivation behind them, but rather are looking to be an irritant, a conclusion I come to based upon your performance up to this point, I respectfully decline to answer your question.
Ok i admit the DNA thing got out of hand but you pushed it along as much as I did.
How about answering these Stout?
Which is why you just can't call out one of the world's premier authorities on the matter and belittle his beliefs (Francis S. Collins). Disagree if you must, no one here is denying you that right. But don't insinuate that Collin's scientific viewpoints hold no merit whatsoever simply because he happens to believe in GOD.
Edit: Nevermind, I see ES completely dismantled your position already.
I just googled him. Thats ing hilarious.
Hey Phenom what church would you recomend in Corpus?
I saw Jesus on Southpark last night. A jew, Kyle, killed him and he came back to save people for Easter.
ROFL, im going to have to side with the one and only on this one
and also pfhenomanual has loads of scientific credentials, dont even make him list them again
There are currently 1 users browsing this thread. (0 members and 1 guests)
Posting Permissions